SGN Marker C2_At2g20360

SGN-M7245
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301766 (SGN)
119625 (CGN)
---
Capsicum annuumSingleSGN-U201562---
Solanum tuberosumSingleSGN-U244251---
ArabidopsisSingleAt2g20360 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38310)
Chromosome
9
Position
50.25 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39572
Forward primer (5'-3')
TCGCTACAGTCTTTGGAGCTACTGG
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
250
Approximate temperature
55°C
Reverse primer (5'-3')
TCCTCAGATCCACGGAAAGGAACC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
250
Solanum pennellii TA56
150
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25660)
Chromosome
2
Position
8.79 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10597
Forward primer (5'-3')
TCGCTACAGTCTTTGGAGCTACTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTCAGATCCACGGAAAGGAACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10598
Forward primer (5'-3')
TCGCTACAGTCTTTGGAGCTACTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTCAGATCCACGGAAAGGAACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10599
Forward primer (5'-3')
TCGCTACAGTCTTTGGAGCTACTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTCAGATCCACGGAAAGGAACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10600
Forward primer (5'-3')
TCGCTACAGTCTTTGGAGCTACTGG
Digested band sizes (using EcoRI)
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 150
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTCAGATCCACGGAAAGGAACC
Enzymes
All possible enzymes for pennellii and and lycopersicum: EcoRI
  
Accessions and product sizes
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Amplicon sequence alignment, FASTA
At2g20360F.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At2g20360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7245 marker 7245
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)