SGN Marker SSR62

SGN-M735

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 40
Repeat motif: TAA   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: TGCAAATGAATGTCCAGGAT
Reverse primer: TCAGCAGAGTTATGCCATGC
Predicted size: 234
Derivations 
This marker was derived from EST read SGN-E53931
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39283)
Chromosome
5
Position
10.50 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 32110
Forward primer (5'-3')
TGCAAATGAATGTCCAGGAT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCAGCAGAGTTATGCCATGC
Enzymes
  
Accessions and product sizes
Approximate temperature
40°C
  
Overgo hybridization and physical mapping 
SSR62 was used as an overgo probe on plate 11 [well D10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAAATTACCCTCCTCCAAAGTGGG
B sequence
GCTCCACCTTGATTATCCCACTTT
AB sequence
GAAATTACCCTCCTCCAAAGTGGGATAATC
Marker sequence
AAAATAATGGAAGAACAACTAAATTCTTTAGCTATTACTCATCTTCTTCA
ACACTCTTTAAGAAGTTTATGTATTCATGAAAATTCTCAATGGGTTTATG
CTGTCTTTTGGAGAATCTTGCCTAGAAATTACCCTCCTCCAAAGTGGGAT
AATCAAGGTGGAGCATATGATAGGTCAAGAGGAAATAGAAGAAATTGGAT
TTTGGTATGGGAAGATGGTTTTTGCAATTTTGCAGCATCAACGGCTGAGA
TTAATGCAAATGAATGTCCAGGATCATCTTCTAATAATAATAATAATAAT
AATTATGGAGAATATCAACATTATCAAGGTCTTCAACCTGAACTTTTTTT
CAAGATGTCACATGAAATTTACAACTATGGAGAAGGTATAATTGGAAAAG
TGGCAGCAGATCATAGTCATAAATGGATCTATAAAGAACCAAATGAACAA
GAGATTAATTTCTTGTCTGCATGGCATAACTCTGCTGATTCTCACCCTAG
AACT
Genomic location of SSR62  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D735 marker 735
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)