SGN Marker C2_At2g41380

SGN-M7481
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303866 (SGN)
121514 (CGN)
---
Lycopersicon CombinedMultipleSGN-U213285---
Solanum tuberosumSingleSGN-U246574---
ArabidopsisSingleAt2g41380 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38381)
Chromosome
4
Position
56.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41301
Forward primer (5'-3')
ACAACAATATTCAAAGGGTAGGCCAAG
Accessions and product sizes
Solanum lycopersicum TA209
750
Solanum pennellii TA56
750
Approximate temperature
55°C
Reverse primer (5'-3')
AACATTTGGAACCTTTGCTGCAAATTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
575
Solanum pennellii TA56
525
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25904)
Chromosome
2
Position
17.26 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At2g41380  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7481 marker 7481
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)