SGN Marker C2_At2g42750

SGN-M7500
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308948 (SGN)
131584 (CGN)
---
Capsicum annuumSingleSGN-U197776---
Lycopersicon CombinedSingleSGN-U222096---
ArabidopsisSingleAt2g42750 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46644)
Chromosome
7
Position
9.40 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42204)
Chromosome
7
Position
81.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43770
Forward primer (5'-3')
AAGAAGGCATACTATAGTTGCATGAA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACTCTAGCTCTTCCAAAGTCTTCCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41392)
Chromosome
7
Position
86.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43368
Forward primer (5'-3')
TCCAGTGCAAAGGAGAGTTTATGATG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACTCTAGCTCTTCCAAAGTCTTCCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38387)
Chromosome
7
Position
44.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39636
Forward primer (5'-3')
TCCAGTGCAAAGGAGAGTTTATGATG
Accessions and product sizes
Solanum lycopersicum TA209
1650
Solanum pennellii TA56
1650
Approximate temperature
55°C
Reverse primer (5'-3')
ACTCTAGCTCTTCCAAAGTCTTCCTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1650
Solanum lycopersicum TA209
700+950
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25923)
Chromosome
2
Position
17.80 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10848
Forward primer (5'-3')
TCCAGTGCAAAGGAGAGTTTATGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTCTAGCTCTTCCAAAGTCTTCCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 10849
Forward primer (5'-3')
TCCAGTGCAAAGGAGAGTTTATGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTCTAGCTCTTCCAAAGTCTTCCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 10850
Forward primer (5'-3')
TCCAGTGCAAAGGAGAGTTTATGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTCTAGCTCTTCCAAAGTCTTCCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 10851
Forward primer (5'-3')
TCCAGTGCAAAGGAGAGTTTATGATG
Digested band sizes (using TaqI)
Solanum pennellii LA716: 520
Solanum lycopersicum LA925: 500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTCTAGCTCTTCCAAAGTCTTCCTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AdeI/DraIII,AluI,BclI,DpnII,HincII,Hpy188I,RsaI,TaqI
All possible enzymes for lycopersicum and pimpinellifolium: AdeI/DraIII,BstUI,HincII,Hpy188I,RsaI
  
Accessions and product sizes
Solanum pennellii LA716: 650
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Amplicon sequence alignment, FASTA
At2g42750F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At2g42750  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7500 marker 7500
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)