SGN Marker C2_At2g45730

SGN-M7535
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302296 (SGN)
124295 (CGN)
---
Lycopersicon CombinedSingleSGN-U223440---
Solanum tuberosumSingleSGN-U258539---
ArabidopsisSingleAt2g45730 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38397)
Chromosome
4
Position
129.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39643
Forward primer (5'-3')
TCCATTCGGGTCTCTGTTTCAAG
Accessions and product sizes
Solanum lycopersicum TA209
600
Solanum pennellii TA56
600
Approximate temperature
55°C
Reverse primer (5'-3')
TTTCGCATCTCGTCAATATCTTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
150
Solanum lycopersicum TA209
290
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25959)
Chromosome
2
Position
18.84 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10875
Forward primer (5'-3')
TCCATTCGGGTCTCTGTTTCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCGCATCTCGTCAATATCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 10876
Forward primer (5'-3')
TCCATTCGGGTCTCTGTTTCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCGCATCTCGTCAATATCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 10877
Forward primer (5'-3')
TCCATTCGGGTCTCTGTTTCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCGCATCTCGTCAATATCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13101
Forward primer (5'-3')
TCCATTCGGGTCTCTGTTTCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCGCATCTCGTCAATATCTTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13102
Forward primer (5'-3')
TCCATTCGGGTCTCTGTTTCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCGCATCTCGTCAATATCTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13103
Forward primer (5'-3')
TCCATTCGGGTCTCTGTTTCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCGCATCTCGTCAATATCTTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13104
Forward primer (5'-3')
TCCATTCGGGTCTCTGTTTCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCGCATCTCGTCAATATCTTC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32626
Forward primer (5'-3')
TCCATTCGGGTCTCTGTTTCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCGCATCTCGTCAATATCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32975
Forward primer (5'-3')
TCCATTCGGGTCTCTGTTTCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCGCATCTCGTCAATATCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32976
Forward primer (5'-3')
TCCATTCGGGTCTCTGTTTCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCGCATCTCGTCAATATCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32977
Forward primer (5'-3')
TCCATTCGGGTCTCTGTTTCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCGCATCTCGTCAATATCTTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32978
Forward primer (5'-3')
TCCATTCGGGTCTCTGTTTCAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCGCATCTCGTCAATATCTTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 10878
Forward primer (5'-3')
TCCATTCGGGTCTCTGTTTCAAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 1250
Solanum pennellii LA716: 1300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCGCATCTCGTCAATATCTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
All possible enzymes for lycopersicum and pimpinellifolium: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 1250
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. quitoense plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #1, plain text
Forward amplicon sequence for S. betaceum 04T132, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 04T132, plain text

Genomic location of C2_At2g45730  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7535 marker 7535
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)