SGN Marker C2_At3g13800

SGN-M7732
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310332 (SGN)
127844 (CGN)
---
Lycopersicon CombinedSingleSGN-U230746---
ArabidopsisSingleAt3g13800 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38463)
Chromosome
3
Position
159.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39703
Forward primer (5'-3')
ACACTTGACGCGGTCATTATTACTC
Accessions and product sizes
Solanum pennellii TA56
1700
Solanum lycopersicum TA209
1600
Approximate temperature
50°C
Reverse primer (5'-3')
AATTGGAACGGAGGGCTGGAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26160)
Chromosome
3
Position
4.54 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g13800  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7732 marker 7732
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)