SGN Marker C2_At3g16290

SGN-M7757
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U203398---
Lycopersicon CombinedSingleSGN-U221887---
ArabidopsisSingleAt3g16290 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49244)
Chromosome
12
Position
44.76 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47178)
Chromosome
12
Position
61.08 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46668)
Chromosome
12
Position
61.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46485)
Chromosome
12
Position
12.60 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38474)
Chromosome
12
Position
64.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39713
Forward primer (5'-3')
ACGCTCGTAAGAAGCCTATGGCTC
Accessions and product sizes
Solanum lycopersicum TA209
450
Solanum pennellii TA56
450
Approximate temperature
55°C
Reverse primer (5'-3')
TCGTTCTTCAATTTGTGCAGCTTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
150
Solanum lycopersicum TA209
225
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26187)
Chromosome
3
Position
5.52 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At3g16290  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D7757 marker 7757
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)