SGN Marker SSR124

SGN-M797

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 45
Repeat motif: CACC   Repeat number: 2
Repeat motif: GA   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: TCAATCCATCACACCTTGGA
Reverse primer: GAGGAAGAAGACCACGCAAA
Predicted size: 131
Derivations 
This marker was derived from EST read SGN-E136488
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49361)
Chromosome
12
Position
45.08 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47296)
Chromosome
12
Position
60.59 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39169)
Chromosome
12
Position
60.00 cM
Confidence
CF(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 152
Forward primer (5'-3')
TCAATCCATCACACCTTGGA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GAGGAAGAAGACCACGCAAA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300+1270
Solanum lycopersicum LA925: 1300+1300
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
SSR124 was used as an overgo probe on plate 1 [well B11]

Plausible BAC Matches:   P095F11,   P246A12,   P288K15,   P291L20,   P314C05,   P333P15,   P110J17,   P061J21,   P015L02,   P074C06,   P013P16,   P211D08,   P243L18,   P245B16,   P165I20,   P135K08,   P059A05,   P255N10,   P173L24,   P027F17

 Overgo Sequences

A sequence
CTTCTCTCTCACTCTGCCCAAAAC
B sequence
AGGAGAACATGGCTGAGTTTTGGG
AB sequence
CTTCTCTCTCACTCTGCCCAAAACTCAGCC
Marker sequence
GGGAAGATAAAGAGCAGTACTTGTTGAGCAGATCTATCACAAACAATCTC
TTCTCTCTCACTCTGCCCAAAACTCAGCCATGTTCTCCTTGAATGGCACC
AGTTTTACGAACAATTCGTTATCTGGGGTTTCAAGATGTTTGAATCAGTC
AAGCAGAAGAGTTTCAGCTCCTATGGTGGTGGTAGCCGCCGTGAACTCAA
ACGGAAAACCTGGAGATGGAAGTGTTAGTGTATTGGTTGAGAATGCTTTG
ACGGAAAGTCCTGCACCGGTTGAGATGGAGGTTAAATCTACTGTTACTGG
TGGAGTTCAAGACGTTTATGGTGAGGATAGTGCCACAGAAGATCAATCCA
TCACACCTTGGACCTTATCTGTTGCTAGTGGTTTCTCATTGTTGCGTAAC
CCACACTACAATAAGGGCCTTGCTTTCTCTGAGAGAGAGAGAGACACCCA
CCATTTGCGTGGTCTTCTTCCTCCTGTCGTAATTAGTCATGACCTTCAGG
TCAAGAAAATGATGAACAGCATCCGTAAGTATGATGTA
Genomic location of SSR124  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D797 marker 797
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)