SGN Marker C2_At3g63190

SGN-M8127
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303040 (SGN)
125345 (CGN)
---
Capsicum annuumSingleSGN-U201290---
Lycopersicon CombinedSingleSGN-U218281---
Solanum tuberosumSingleSGN-U248642---
ArabidopsisSingleAt3g63190 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49262)
Chromosome
9
Position
58.94 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47198)
Chromosome
9
Position
53.95 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42233)
Chromosome
9
Position
50.90 cM
Confidence
I(LOD2)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43799
Forward primer (5'-3')
TTGGTGCAGCCGTATGACAAATCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCCATCATTATTTGGCGTCATACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38596)
Chromosome
9
Position
52.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39788
Forward primer (5'-3')
TTGGTGCAGCCGTATGACAAATCC
Accessions and product sizes
Solanum lycopersicum TA209
450
Solanum pennellii TA56
500
Approximate temperature
50°C
Reverse primer (5'-3')
TCCATCATTATTTGGCGTCATACC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
450
Solanum pennellii TA56
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26564)
Chromosome
3
Position
23.35 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11306
Forward primer (5'-3')
TTGGTGCAGCCGTATGACAAATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCATCATTATTTGGCGTCATACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
50°C
  
PCR data   Exp. ID 11307
Forward primer (5'-3')
TTGGTGCAGCCGTATGACAAATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCATCATTATTTGGCGTCATACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Approximate temperature
50°C
  
PCR data   Exp. ID 11308
Forward primer (5'-3')
TTGGTGCAGCCGTATGACAAATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCATCATTATTTGGCGTCATACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
50°C
  
PCR data   Exp. ID 32639
Forward primer (5'-3')
TTGGTGCAGCCGTATGACAAATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCATCATTATTTGGCGTCATACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33074
Forward primer (5'-3')
TTGGTGCAGCCGTATGACAAATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCATCATTATTTGGCGTCATACC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 33075
Forward primer (5'-3')
TTGGTGCAGCCGTATGACAAATCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCATCATTATTTGGCGTCATACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11309
Forward primer (5'-3')
TTGGTGCAGCCGTATGACAAATCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCATCATTATTTGGCGTCATACC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
All possible enzymes for lycopersicum and pimpinellifolium: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 500
Approximate temperature
50°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At3g63190  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8127 marker 8127
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)