Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker C2_At4g12740

SGN-M8232
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U202766---
Solanum tuberosumSingleSGN-U262248---
ArabidopsisSingleAt4g12740 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46715)
Chromosome
7
Position
54.80 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46504)
Chromosome
7
Position
57.30 cM
Confidence
F(LOD3)
Protocol
PCR


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38636)
Chromosome
9
Position
50.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39821
Forward primer (5'-3')
AATGTGGGCTGGTTTGGGGTATTAT
Accessions and product sizes
Solanum pennellii TA56
425
Solanum lycopersicum TA209
425
Approximate temperature
55°C
Reverse primer (5'-3')
TCCTTCTTCAACCACCTCTTTTGCACC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
250
Solanum lycopersicum TA209
350
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26673)
Chromosome
4
Position
7.50 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At4g12740  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8232 marker 8232
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)