SGN Marker C2_At4g21800

SGN-M8324
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300802 (SGN)
121093 (CGN)
---
Lycopersicon CombinedSingleSGN-U217163---
Solanum tuberosumMultipleSGN-U247262---
ArabidopsisSingleAt4g21800 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38666)
Chromosome
8
Position
76.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39844
Forward primer (5'-3')
TTCTCCATCGACTTGTTTGCCACAC
Accessions and product sizes
Solanum lycopersicum TA209
600
Solanum pennellii TA56
600
Approximate temperature
55°C
Reverse primer (5'-3')
TGGGAAAAGTAGATGCAAAAGCTTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
200+275
Solanum lycopersicum TA209
475
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26764)
Chromosome
4
Position
11.57 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32488
Forward primer (5'-3')
TTCTCCATCGACTTGTTTGCCACAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGGAAAAGTAGATGCAAAAGCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Approximate temperature
58°C
  
PCR data   Exp. ID 32489
Forward primer (5'-3')
TTCTCCATCGACTTGTTTGCCACAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGGAAAAGTAGATGCAAAAGCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Approximate temperature
58°C
  
PCR data   Exp. ID 32490
Forward primer (5'-3')
TTCTCCATCGACTTGTTTGCCACAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGGAAAAGTAGATGCAAAAGCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 900
Approximate temperature
58°C
  
PCR data   Exp. ID 32491
Forward primer (5'-3')
TTCTCCATCGACTTGTTTGCCACAC
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 1400
Solanum lycopersicum LA925: 900
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGGGAAAAGTAGATGCAAAAGCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Solanum lycopersicum LA925: 900
Approximate temperature
58°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At4g21800  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8324 marker 8324
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)