SGN Marker C2_At4g22200

SGN-M8328
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303993 (SGN)
124633 (CGN)
---
Capsicum annuumSingleSGN-U197962---
Lycopersicon CombinedSingleSGN-U217439---
Solanum tuberosumSingleSGN-U251403---
ArabidopsisSingleAt4g22200 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38668)
Chromosome
1
Position
132.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39845
Forward primer (5'-3')
CACCAGACGAGTTGTACATCATAGTGCC
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26768)
Chromosome
4
Position
11.75 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11457
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AGGTATGTACTCAGCCTTCATATCTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 11458
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AGGTATGTACTCAGCCTTCATATCTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 11459
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AGGTATGTACTCAGCCTTCATATCTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 12319
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12320
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12321
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12322
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12323
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12324
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12325
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12326
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12327
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12328
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12329
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12330
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33360
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33361
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33362
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33363
Forward primer (5'-3')
TTAAAGGTGTCACAAAGGAAATTCTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTCTTCAAGGAAAGTAGCATTACC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 700
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At4g22200  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8328 marker 8328
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)