SGN Marker C2_At4g31410

SGN-M8421
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300576 (SGN)
122928 (CGN)
---
Capsicum annuumSingleSGN-U200912---
ArabidopsisSingleAt4g31410 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46513)
Chromosome
12
Position
46.60 cM
Confidence
F(LOD3)
Protocol
dCAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38695)
Chromosome
12
Position
85.90 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39871
Forward primer (5'-3')
TCCCTGCCCCTTGTGTAGAGGAG
Accessions and product sizes
Solanum lycopersicum TA209
375
Solanum pennellii TA56
400
Approximate temperature
55°C
Reverse primer (5'-3')
TCAACCCCATAATCTACATACTCTACAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
375
Solanum pennellii TA56
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26865)
Chromosome
4
Position
15.24 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32523
Forward primer (5'-3')
TCCCTGCCCCTTGTGTAGAGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACCCCATAATCTACATACTCTACAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Approximate temperature
50°C
  
PCR data   Exp. ID 32524
Forward primer (5'-3')
TCCCTGCCCCTTGTGTAGAGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACCCCATAATCTACATACTCTACAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 550
Approximate temperature
50°C
  
PCR data   Exp. ID 32525
Forward primer (5'-3')
TCCCTGCCCCTTGTGTAGAGGAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACCCCATAATCTACATACTCTACAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 550
Approximate temperature
50°C
  
PCR data   Exp. ID 32526
Forward primer (5'-3')
TCCCTGCCCCTTGTGTAGAGGAG
Digested band sizes (using CfoI)
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCAACCCCATAATCTACATACTCTACAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 550
Solanum pennellii LA716: 550
Approximate temperature
50°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At4g31410  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8421 marker 8421
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)