SGN Marker C2_At4g35335

SGN-M8477
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle311801 (SGN)
127793 (CGN)
---
Lycopersicon CombinedSingleSGN-U220447---
Solanum tuberosumSingleSGN-U264811---
ArabidopsisSingleAt4g35335 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 26922)
Chromosome
4
Position
16.81 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41635
Forward primer (5'-3')
TGTGGCCTTGCTAAGAATCTGGAG
Accessions and product sizes
Solanum pennellii TA56
1100
Solanum lycopersicum TA209
1100
Approximate temperature
55°C
Reverse primer (5'-3')
AAAGTAGAATGAAAGCAGCCCACTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
300+525+800
Solanum lycopersicum TA209
525+1100
Mg+2 concentration
1.5mM
   Enzymes
  
Universal primers for Asterid species 
No additional PCR data found.
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At4g35335  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8477 marker 8477
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)