SGN Marker C2_At4g35560

SGN-M8481
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309549 (SGN)
132514 (CGN)
---
Lycopersicon CombinedSingleSGN-U227978---
Solanum tuberosumSingleSGN-U262232---
ArabidopsisSingleAt4g35560 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41497)
Chromosome
2
Position
91.60 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43473
Forward primer (5'-3')
AGTTCAACACGTGTAGCTTGCATGG
Accessions and product sizes
Approximate temperature
65°C
Reverse primer (5'-3')
AACAGATCAATACTAATGGTTGCTTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38716)
Chromosome
2
Position
78.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39886
Forward primer (5'-3')
AGTTCAACACGTGTAGCTTGCATGG
Accessions and product sizes
Solanum lycopersicum TA209
875
Solanum pennellii TA56
850
Approximate temperature
55°C
Reverse primer (5'-3')
AACAGATCAATACTAATGGTTGCTTTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
875
Solanum pennellii TA56
850
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26926)
Chromosome
4
Position
16.88 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 32543
Forward primer (5'-3')
AGTTCAACACGTGTAGCTTGCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGATCAATACTAATGGTTGCTTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 32544
Forward primer (5'-3')
AGTTCAACACGTGTAGCTTGCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGATCAATACTAATGGTTGCTTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 32545
Forward primer (5'-3')
AGTTCAACACGTGTAGCTTGCATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGATCAATACTAATGGTTGCTTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 32546
Forward primer (5'-3')
AGTTCAACACGTGTAGCTTGCATGG
Digested band sizes (using HinfI)
Solanum pennellii LA716: 150+200
Solanum lycopersicum LA925: 350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGATCAATACTAATGGTTGCTTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At4g35560  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8481 marker 8481
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)