SGN Marker C2_At5g06130

SGN-M8595
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302226 (SGN)
121649 (CGN)
---
Capsicum annuumSingleSGN-U201082---
ArabidopsisSingleAt5g06130 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41507)
Chromosome
9
Position
0.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43483
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38750)
Chromosome
9
Position
37.60 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39907
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
Accessions and product sizes
Solanum lycopersicum TA209
100
Solanum pennellii TA56
100
Approximate temperature
55°C
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27046)
Chromosome
5
Position
1.85 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11638
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11639
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11640
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13637
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13638
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 13639
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13640
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13641
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13642
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13643
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 13644
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 310
Approximate temperature
55°C
  
PCR data   Exp. ID 13645
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 310
Approximate temperature
55°C
  
PCR data   Exp. ID 13646
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 310
Approximate temperature
55°C
  
PCR data   Exp. ID 32648
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 33171
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 33172
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 33173
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 33174
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 33175
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 11641
Forward primer (5'-3')
AGTGCAAATATTGCTATGGAAGTG
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 200
Solanum pennellii LA716: 250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGAACATCGTGCACATGCCAAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, DraI, KpnI
  
Accessions and product sizes
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g06130  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8595 marker 8595
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)