SGN Marker C2_At5g06760

SGN-M8603
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303279 (SGN)
125340 (CGN)
---
Lycopersicon CombinedSingleSGN-U237017---
ArabidopsisSingleAt5g06760 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38756)
Chromosome
1
Position
115.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41680
Forward primer (5'-3')
AAGCAAACAGCAGCTAATGTTGCCG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TGTCTCGAGGCTGCGTTCTGCTCCT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27056)
Chromosome
5
Position
2.09 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g06760  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8603 marker 8603
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)