SGN Marker SSR201

SGN-M874

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 47.619 High: 45.455
Repeat motif: TCTT   Repeat number: 6
Repeat motif:    Repeat number:
Forward primer: AAGACAGAAAGTGCACGTCAGA
Reverse primer: TGGATGAGAAGAGGGAATCCT
Predicted size: 103
Derivations 
This marker was derived from EST read SGN-E178370
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49365)
Chromosome
3
Position
63.82 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47300)
Chromosome
3
Position
126.72 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39188)
Chromosome
3
Position
162.00 cM
Confidence
CF(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31798
Forward primer (5'-3')
AAGACAGAAAGTGCACGTCAGA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGGATGAGAAGAGGGAATCCT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 103
Approximate temperature
45°C
  
Overgo hybridization and physical mapping 
SSR201 was used as an overgo probe on plate 2 [well G7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGAAAGTGCACGTCAGAGTTAGCC
B sequence
AAAGAGACCACCCTACGGCTAACT
AB sequence
AGAAAGTGCACGTCAGAGTTAGCCGTAGGG
Marker sequence
CATTTGAGACTTTGTTAAAAGGCAGAATTATTAGTAATAATACAATAAAG
AAAGATGATATTTTTTTAAAAAAATTTCTTTGTTTCTGGGGTTTGAGAAG
AGAACAAAAGAAAAGACAGAAAGTGCACGTCAGAGTTAGCCGTAGGGTGG
TCTCTTTCTTTCTTTCTTTCTTTCTTGTGGAGAGGATTACAGAGAGGATT
CCCTCTTCTCATCCAAATCTCTTTCTCTTTCTTAACAGTTGTAAGAAATT
TGGTCCAGTTTTATTTGTTCTTATATGCATGTTTATTATTGGATTTTCTT
GATTTTAGCAAGTTGATTATATATCTATTGGAAACTTGAATGAAAAAAAA
AAAAGTCTTCTTTCTTTCTCATTTTCTTTTGGGGTTTGGGAAAAACAAGA
TTTGTTTGTTGGGTTGATGCCAAAGGAAGAAGAAACCACAAGACTAGAGA
GGTAGCTGAAGGTGTTTCCTTTTATTCTTTTCTTTTTTTCAGGTTCAACC
AATTTAGTGTTCTTTTTTCCTCTATGTAGTTTTGGCCATTATATATATCA
TCTACTTTATCTTTTTCTAGGTTTGGTTTTTGTCTTTAGATTTCTTAACA
TATTTATATCTTTATAGC
Genomic location of SSR201  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D874 marker 874
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)