SGN Marker C2_At5g23520

SGN-M8816
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309312 (SGN)
129219 (CGN)
---
Lycopersicon CombinedMultipleSGN-U222031---
Solanum tuberosumSingleSGN-U256491---
ArabidopsisSingleAt5g23520 on TAIR---
Mapped locations  
Map: Tobacco N. acuminata   
Map version
89 (location: 46530)
Chromosome
5
Position
13.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38820)
Chromosome
5
Position
119.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39946
Forward primer (5'-3')
TGAGCTTTGTACCGGTTGAGCCTGA
Accessions and product sizes
Solanum lycopersicum TA209
2200
Solanum pennellii TA56
2200
Approximate temperature
55°C
Reverse primer (5'-3')
TAGAGAAAAATGTTGGGCAGATAAGTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
900
Solanum lycopersicum TA209
600
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27277)
Chromosome
5
Position
7.93 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At5g23520  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8816 marker 8816
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)