SGN Marker C2_At5g37290

SGN-M8888
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeMultiple302355 (SGN)
121643 (CGN)
---
Capsicum annuumSingleSGN-U201849---
Lycopersicon CombinedSingleSGN-U227358---
ArabidopsisSingleAt5g37290 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46765)
Chromosome
4
Position
12.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46533)
Chromosome
4
Position
16.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38847)
Chromosome
4
Position
49.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41790
Forward primer (5'-3')
TCGTCATCCAGTGTTTGTCAAGTCCTGT
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TTTAAGATCTCTTCCTTGTTTGATGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27352)
Chromosome
5
Position
14.78 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g37290  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8888 marker 8888
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)