SGN Marker C2_At5g38880

SGN-M8899
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310199 (SGN)
131779 (CGN)
---
Lycopersicon CombinedSingleSGN-U226975---
ArabidopsisSingleAt5g38880 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109246)
Chromosome
3
Position
18.29 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38851)
Chromosome
3
Position
76.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39961
Forward primer (5'-3')
TGGTAATGCTAAACACTGCCTTGACG
Accessions and product sizes
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
1650
Approximate temperature
53°C
Reverse primer (5'-3')
ATGCTGGTTGTTCCCACCATTCATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
1650
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27364)
Chromosome
5
Position
15.58 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11873
Forward primer (5'-3')
TGGTAATGCTAAACACTGCCTTGACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCTGGTTGTTCCCACCATTCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 11874
Forward primer (5'-3')
TGGTAATGCTAAACACTGCCTTGACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCTGGTTGTTCCCACCATTCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 11875
Forward primer (5'-3')
TGGTAATGCTAAACACTGCCTTGACG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCTGGTTGTTCCCACCATTCATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 11876
Forward primer (5'-3')
TGGTAATGCTAAACACTGCCTTGACG
Digested band sizes (using EcoRV)
Solanum lycopersicum LA925: 1100
Solanum pennellii LA716: 950
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATGCTGGTTGTTCCCACCATTCATC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, DraI, EcoRV, DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g38880  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8899 marker 8899
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)