SGN Marker C2_At5g42950

SGN-M8940
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302215 (SGN)
123686 (CGN)
---
Lycopersicon CombinedSingleSGN-U219152---
Solanum tuberosumSingleSGN-U249275---
ArabidopsisSingleAt5g42950 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46769)
Chromosome
4
Position
83.30 cM
Confidence
I(LOD2)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Pepper-COSII   
Map version
58 (location: 41535)
Chromosome
4
Position
139.60 cM
Confidence
I
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43511
Forward primer (5'-3')
CTCTTCTGGAACACATTATCGTCCCAA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACATTTTTGGCACTTGCACCAGTGAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38862)
Chromosome
4
Position
119.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39968
Forward primer (5'-3')
AGCAATGGATTTCAGAGAATGGTGTG
Accessions and product sizes
Solanum lycopersicum TA209
1300
Approximate temperature
55°C
Reverse primer (5'-3')
ACATTTTTGGCACTTGCACCAGTGAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27406)
Chromosome
5
Position
17.25 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11905
Forward primer (5'-3')
AGCAATGGATTTCAGAGAATGGTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATTTTTGGCACTTGCACCAGTGAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11906
Forward primer (5'-3')
AGCAATGGATTTCAGAGAATGGTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATTTTTGGCACTTGCACCAGTGAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 11907
Forward primer (5'-3')
AGCAATGGATTTCAGAGAATGGTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATTTTTGGCACTTGCACCAGTGAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 11908
Forward primer (5'-3')
AGCAATGGATTTCAGAGAATGGTGTG
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 450
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATTTTTGGCACTTGCACCAGTGAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 450
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text
Forward amplicon sequence for S. quitoense SE plant #1 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1 (2), plain text


Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. betaceum 285028 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 285028 plant #2, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120039 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text
Forward amplicon sequence for S. quitoense SE plant #1 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1 (2), plain text

Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of C2_At5g42950  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8940 marker 8940
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)