SGN Marker C2_At5g48300

SGN-M8992
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302575 (SGN)
122122 (CGN)
---
Lycopersicon CombinedMultipleSGN-U225539---
Solanum tuberosumSingleSGN-U243268---
ArabidopsisSingleAt5g48300 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42259)
Chromosome
7
Position
85.50 cM
Confidence
I
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43828
Forward primer (5'-3')
ATAAAGTATATAAACCATTATGTATGGTA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AAGGTCAGGCAGACGCTACAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41539)
Chromosome
7
Position
120.10 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43515
Forward primer (5'-3')
TGTGTCTCCTAAGGCTGTTTCTGATTC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TGCGGCAACGGTAATATCAGCATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38877)
Chromosome
12
Position
47.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39979
Forward primer (5'-3')
TGTGTCTCCTAAGGCTGTTTCTGATTC
Accessions and product sizes
Solanum pennellii TA56
200
Solanum lycopersicum TA209
200
Approximate temperature
55°C
Reverse primer (5'-3')
TGCGGCAACGGTAATATCAGCATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
120
Solanum lycopersicum TA209
200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27459)
Chromosome
5
Position
19.59 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11951
Forward primer (5'-3')
TGTGTCTCCTAAGGCTGTTTCTGATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCGGCAACGGTAATATCAGCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200+1500
Approximate temperature
55°C
  
PCR data   Exp. ID 11952
Forward primer (5'-3')
TGTGTCTCCTAAGGCTGTTTCTGATTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCGGCAACGGTAATATCAGCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200+1500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At5g48300  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8992 marker 8992
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)