Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker TG574

SGN-M9

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
950
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TATATCAATTGATTGGTACCTTTGAGAAATGATTTAACTATTTTCTTGGGAAGAGATGCTCTCGGGAAATCTGTTGCAAATTTCCTTGTA
GAGAAAACGAATGGTGATCCTCTTGCAAAAGCAGTGAGCCAATGTGTAATGTATTCAATGCTGGTCTCCATGGATGTCATTGTATATGGT
TCCGTACAGAGATTGTTTTTTTCCAGCAAGGAAAATCTAGAAGACAAAACGTTGTTGTATCAGTAATCTTTTCTATTCTTCATATTCATG
GAGCCTTCAATTAGCAAGTGGAGTCAATGCTAGTAAGGGTAGATGTTCCAAACTCAAAAGGCTTTTGGATCAAATTGCAGCTGAATGAGA
TGTTTTTGCAGAATCAACACGTGCATGCTGGGTCAAGTAGTATCTTTTCATACCTTGTTATTTTTTTTTTTGTTTCATTGTTAGTTTAAA
GTTGGAAGTTCTTTTTTATTTTTAGTTGGTGGATAGCCT
Reverse sequence
CAGCAGGCTCCTCAAGACTGTTATCCAAAATGAATTATTATAAAGTTGCATCAGGCAAATTAAAAACAAAAAAAAGAGGTGTGCTGTACT
ATCCATCCATGTATAGAACAGGCTCCTCGAGATACAAAGAGAAATAAGGGCCATTCATCATCAGCTGGAAAGGTAATGGAGGATAAGACT
CATAAAGAGAGAGGAGGGGTCCTGCATTTTTGTACTTGTACAAGGCTTTCCACACAACATTTATGGGTCTTCACTATCAAGCTGATCATT
CCACATAAAGTGGTCCATGCATATTTGGCATTTATTACCCATCTCACATTTCTTCTAAAAATAACAATAATAAATTCAACAGTCAGGTGC
TAAGAAACAACACATCCTGGAAAGAACCAATATTTTTCTAGAAAGCGAGATGGAGGAGATTCTTCTGACTGACCATTAGGCTATCCACCA
ACTAAAAATAAAAAAGAACTTCCAACTCTAAACTAACAATGAAACAAAAAAAAAAATAACAAGGTATGAAAAGATACTACTTGACCCAGC
ATGCACGTGTTGATTCTGCAAAAACATCTCATTCAGCTGCAATTTGATCCAAAAGCCTTTTGAGTTTGGAACATCTACCCTTACTAGCAT
TGACTC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U147309416 (85.1% of RFLP seq)+
SGN-U1473092.5e-68130 (20.4% of RFLP seq)-
SGN-U1473091.3e-88204 (32.1% of RFLP seq)-
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50412)
Chromosome
4
Position
58.45 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48344)
Chromosome
4
Position
68.06 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40093)
Chromosome
4
Position
84.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 7718)
Chromosome
4
Position
67.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7719)
Chromosome
4
Position
79.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7723)
Chromosome
4
Position
68.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG574 was used as an overgo probe on plate 6 [well F12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CGAATGGTGATCCTCTTGCAAAAG
B sequence
ACACATTGGCTCACTGCTTTTGCA
AB sequence
CGAATGGTGATCCTCTTGCAAAAGCAGTGA
Marker sequence
TATATCAATTGATTGGTACCTTTGAGAAATGATTTAACTATTTTCTTGGG
AAGAGATGCTCTCGGGAAATCTGTTGCAAATTTCCTTGTAGAGAAAACGA
ATGGTGATCCTCTTGCAAAAGCAGTGAGCCAATGTGTAATGTATTCAATG
CTGGTCTCCATGGATGTCATTGTATATGGTTCCGTACAGAGATTGTTTTT
TTCCAGCAAGGAAAATCTAGAAGACAAAACGTTGTTGTATCAGTAATCTT
TTCTATTCTTCATATTCATGGAGCCTTCAATTAGCAAGTGGAGTCAATGC
TAGTAAGGGTAGATGTTCCAAACTCAAAAGGCTTTTGGATCAAATTGCAG
CTGAATGAGATGTTTTTGCAGAATCAACACGTGCATGCTGGGTCAAGTAG
TATCTTTTCATACCTTGTTATTTTTTTTTTTGTTTCATTGTTAGTTTAAA
GTTGGAAGTTCTTTTTTATTTTTAGTTGGTGGATAGCCT
Genomic location of TG574  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9 marker 9
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)