SGN Marker C2_At5g51700

SGN-M9044
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301228 (SGN)
119772 (CGN)
---
Lycopersicon CombinedSingleSGN-U225902---
Solanum tuberosumMultipleSGN-U258759---
ArabidopsisSingleAt5g51700 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38886)
Chromosome
11
Position
103.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39988
Forward primer (5'-3')
AGATGCCACCAGGGATTCTTTTG
Accessions and product sizes
Solanum lycopersicum TA209
750
Solanum pennellii TA56
750
Approximate temperature
55°C
Reverse primer (5'-3')
AGCAGTGTCGTGATTTTCCTTTTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
300
Solanum lycopersicum TA209
320+420
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27514)
Chromosome
5
Position
21.02 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11994
Forward primer (5'-3')
AGATGCCACCAGGGATTCTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTGTCGTGATTTTCCTTTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 11995
Forward primer (5'-3')
AGATGCCACCAGGGATTCTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTGTCGTGATTTTCCTTTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 11996
Forward primer (5'-3')
AGATGCCACCAGGGATTCTTTTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTGTCGTGATTTTCCTTTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 11997
Forward primer (5'-3')
AGATGCCACCAGGGATTCTTTTG
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCAGTGTCGTGATTTTCCTTTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, RsaI
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At5g51700  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9044 marker 9044
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)