SGN Marker U213812

SGN-M9534

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40200)
Chromosome
4
Position
71.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14039
Forward primer (5'-3')
ATATTGAAAAGGATGAATATTGGGG
Digested band sizes (using HinfI)
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 150
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AAAATTCCTTCAGGAAATACTTCTCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 14039
Forward primer (5'-3')
ATATTGAAAAGGATGAATATTGGGG
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 150
Solanum pennellii LA716: 250
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AAAATTCCTTCAGGAAATACTTCTCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Genomic location of U213812  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9534 marker 9534
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)