SGN Marker U231219

SGN-M9545

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51059)
Chromosome
7
Position
1.17 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48995)
Chromosome
7
Position
3.75 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40238)
Chromosome
7
Position
2.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14055
Forward primer (5'-3')
AGTCTCTTGCTTGAGTCTGGAGTTG
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 300
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCTGGGAATATAATCAGCAAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 14055
Forward primer (5'-3')
AGTCTCTTGCTTGAGTCTGGAGTTG
Digested band sizes (using RsaI)
Solanum pennellii LA716: 300
Solanum lycopersicum LA925: 450
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCTGGGAATATAATCAGCAAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Genomic location of U231219  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9545 marker 9545
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)