Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker U217757

SGN-M9563

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U217757
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40209)
Chromosome
1
Position
116.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35640
Forward primer (5'-3')
TCTGATGGCGTCATCTCAAA
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 150+350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCATGGCTTTGATTTGCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 550
Approximate temperature
53°C
  
Genomic location of U217757  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9563 marker 9563
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)