SGN Marker SSRB50753

SGN-M9592

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39311)
Chromosome
3
Position
72.60 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35682
Forward primer (5'-3')
TGCAACATCTTAGCTCCAAGCTAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CATGGACCAAGAATATGGAAACTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum TA209: 390
Solanum pennellii TA56: 410
Approximate temperature
55°C
  
PCR data   Exp. ID 35682
Forward primer (5'-3')
TGCAACATCTTAGCTCCAAGCTAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CATGGACCAAGAATATGGAAACTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum TA209: 390
Solanum pennellii TA56: 410
Approximate temperature
55°C
  
Genomic location of SSRB50753  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9592 marker 9592
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)