SGN Marker SSR293

SGN-M966

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: GAG   Repeat number: 6
Repeat motif:    Repeat number:
Forward primer: GCAAAGAGCTCGATCTCCAA
Reverse primer: TTCAGTTACTGGCCTTCGCT
Predicted size: 129
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39210)
Chromosome
4
Position
109.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31719
Forward primer (5'-3')
GCAAAGAGCTCGATCTCCAA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTCAGTTACTGGCCTTCGCT
Enzymes
  
Accessions and product sizes
Approximate temperature
50°C
  
Genomic location of SSR293  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D966 marker 966
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)