SGN Marker SSR300

SGN-M973

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: TTC   Repeat number: 10
Repeat motif:    Repeat number:
Forward primer: AATGGCAGCTATGATGAGCC
Reverse primer: ACCCGACTTCATTTCACCTG
Predicted size: 246
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53495)
Chromosome
4
Position
94.54 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39211)
Chromosome
3
Position
166.00 cM
Confidence
F(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 53
Forward primer (5'-3')
AATGGCAGCTATGATGAGCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACCCGACTTCATTTCACCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 590+650
Solanum lycopersicum LA925: 650+650
Approximate temperature
55°C
  
Genomic location of SSR300  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D973 marker 973
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)