SGN Marker SSR320

SGN-M993

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: AT   Repeat number: 12
Repeat motif:    Repeat number:
Forward primer: ATGAGGCAATCTTCACCTGG
Reverse primer: TTCAGCTGATAGTTCCTGCG
Predicted size: 171
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53497)
Chromosome
3
Position
83.73 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43799)
Chromosome
3
Position
107.30 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44808
Forward primer (5'-3')
ATGAGGCAATCTTCACCTGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTCAGCTGATAGTTCCTGCG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43259)
Chromosome
3
Position
97.70 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44622
Forward primer (5'-3')
ATGAGGCAATCTTCACCTGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTCAGCTGATAGTTCCTGCG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40794)
Chromosome
3
Position
112.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39221)
Chromosome
3
Position
158.00 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14095
Forward primer (5'-3')
ATGAGGCAATCTTCACCTGG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTCAGCTGATAGTTCCTGCG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 165+171
Solanum lycopersicum LA925: 171+172
Approximate temperature
55°C
  
PCR data   Exp. ID 50
Forward primer (5'-3')
ATGAGGCAATCTTCACCTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTCAGCTGATAGTTCCTGCG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 172+172
Solanum pennellii LA716: 172+179
Approximate temperature
55°C
  
Genomic location of SSR320  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D993 marker 993
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)