Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

EST details — SGN-T178686

Search information 
Request: TPTAV57THMatch: SGN-T178686
Request From: web userMatch Type: Chromatogram internal Identifier
Clone information 
SGN ID: SGN-C110864Clone name: cLPT-6-I18
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E366831Length: 579 bp (877 bp untrimmed)
Status: Chimera not assessed Direction: 5'
>SGN-E366831 [] (trimmed - flagged) CCACCTTGGATGAATACCGTAAATATATTGAGAAAGATCCTGCCCTGGAGCGTCGTTTCCAGCAAGTTTATGTTGACCAGCCTACAGTTGAAGAC
ACTGTCTCCATACTTCGCGGATTACGTGAAAGATATGAGCTACATCACGGGGTTCGCATTTCAGACACTGCGCTTGTCGACGCAGCTATTCTTTC
GGACCGTTATATTAGTGGACGTTTTCTACCTGACAAAGCTATTGACCTAGTTGATGAAGCTGCTGCAAAACTGAAAATGGAGATCACCTCAAAAC
CTACAGCCCTTGACGAGATCAATCGTGCAGTTTTGAAGTTGGAGATGGAGAGGCTATCTCTAACTAATGATACAGATAGAGCATCGAAAGACCGG
GTAAACCGTCTTGAGACTGAGTTGTCTCTTTTGAAGGAGAGGCAAGCTGAGCTGAACTTAAGTACGGGAGTCTAAACACCTTGCAGCGTCAACTT
GAAGCTTCAGAAAAAGAACTGAGTGATTATATGAAGTCTGGAAAATCGATGCTCAGAGAAGAAGTAACTGGGAATGATATTGCAGAGATTGTCAG
TAAGTGGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T178686 [Download] [View] Facility Assigned ID: TPTAV57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Problems: E. Coli (cloning host) sequence detected
Sequence Entropy: 0.978 Expected Error Rate: 0.0062 Quality Trim Threshold: 14.5