EST details — SGN-C10703

Search information 
Request: 10703Match: SGN-C10703
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C10703Clone name: cLEC-6-A15
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172622 is on microarray TOM1: SGN-S1-1-5.1.20.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172622 [TUS-14-A4] Trace: SGN-T195198 EST: SGN-E393872 Direction: 3' Facility: INRA
Clone: SGN-C172622 [TUS-14-A4] Trace: SGN-T195356 EST: SGN-E394030 Direction: 5' Facility: INRA
Clone: SGN-C172622 [TUS-14-A4] Trace: SGN-T195643 EST: SGN-E394317 Direction: 5' Facility: INRA
Clone: SGN-C172622 [TUS-14-A4] Trace: SGN-T195643 EST: SGN-E399006 Direction: 5' Facility: INRA
Clone: SGN-C172622 [TUS-14-A4] Trace: SGN-T195769 EST: SGN-E394443 Direction: 3' Facility: INRA
Clone: SGN-C172622 [TUS-14-A4] Trace: SGN-T195769 EST: SGN-E399533 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202409Length: 564 bp (873 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202409 [] (trimmed) GTAACCGCTAAGGCTGTTTACTCAGCCATAGCTCATCTTGGTGTGACTCATTTTTCTGCTGCACCGGTGGTACTCAACACCATAGTTAACGCCCC
AAAAGAGGAGACTATCCTTCCTCTGCCTCGTCTTGTGCACGTAAGCACAGCTGGTGCTTCTCCTCCTCCATCTGTACTTGCTGCAATGTCACGAC
GTGGTTTCCGTGTCTTACACACTTATGGCCTTTCTGAAACCTATGGTCCATCCACTCTATGCACGTGGAAGCCCGAGTGGGATTTACTTCCTCCA
GACATCCAAGCACGTCTACAAGCACGCCAAGGTGTCAGGTACGTTGGTCTAGAGCATTTAGACGTTGTCAGTACAAACGACATGAAACCTGTCCC
AGCAGATGGAAAAACAATAGGGGAGATCGTCTTTAGAGGTAATATTGTGATGAAAGGTTACTTGAAGAATCCGAAAGCTAACGAGGAAGCTTTTG
CTGGAGGCTGGTATCATTCGGGTGATCTTGCTGTTAAACATCCAGACGGATACATAGAAATCAAAGACAGATCAAAGGACATCATCATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202409] SGN-U572389 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24070 [Download][View] Facility Assigned ID: TCAAU08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.990 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5