EST details — SGN-C10732

Search information 
Request: 10732Match: SGN-C10732
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C10732Clone name: cLEC-6-B6
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172640 is on microarray TOM1: SGN-S1-1-3.1.20.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172640 [TUS-14-A22] Trace: SGN-T195206 EST: SGN-E393880 Direction: 3' Facility: INRA
Clone: SGN-C172640 [TUS-14-A22] Trace: SGN-T195649 EST: SGN-E394323 Direction: 5' Facility: INRA
Clone: SGN-C172640 [TUS-14-A22] Trace: SGN-T195773 EST: SGN-E394447 Direction: 3' Facility: INRA
Clone: SGN-C172640 [TUS-14-A22] Trace: SGN-T195773 EST: SGN-E399018 Direction: 3' Facility: INRA
Clone: SGN-C172640 [TUS-14-A22] Trace: SGN-T200202 EST: SGN-E399019 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202360Length: 470 bp (767 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202360 [] (trimmed) AATAATATTCTCATTATACGTAATTATTCATTTAGAATAAAGTTTTCTTATACCTTCTTTTGATTATCTATTAATCATTACAAATGGAGAGAAAA
ACATCTCAAATCCAACCACCAACTTATGGAGATTTCATCACTATTCTTAGTATTGATGGAGGTGGCATTCGAGGAATTATTCCAGCTACCATCCT
CACTTTTCTTGAATCACAACTTCAGGAGTTGGATGGAAAAAATGCAAGAATTGCAGATTACTTTGATGTTATTGCCGGAACTAGCACCGGTGGCC
TTGTTACGGCCATGTTAACGGCTCCAGATGAAAATCATCGTCCACTTTATGCTGCTAAGGATATTACACCGTTCTATTTAGAGCATTGTCCAAAA
ATATTTCCACAAAAGAAATGTGGTTTGTTTGCTCCAATTGGGAAGATGGTGCAAGCTTTAATAGGGCCAAAATATGATGGAAAGTATCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202360] SGN-U577730 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24021 [Download][View] Facility Assigned ID: TCAAX03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0208 Quality Trim Threshold: 14.5