Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C10805

Search information 
Request: 10805Match: SGN-C10805
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C10805Clone name: cLEC-6-F14
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172688 is on microarray TOM1: SGN-S1-1-3.3.20.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172688 [TUS-14-C22] Trace: SGN-T1260 EST: SGN-E378336 Direction: 5' Facility: Giov. Lab
Clone: SGN-C172688 [TUS-14-C22] Trace: SGN-T195216 EST: SGN-E393890 Direction: 3' Facility: INRA
Clone: SGN-C172688 [TUS-14-C22] Trace: SGN-T195368 EST: SGN-E394042 Direction: 5' Facility: INRA
Clone: SGN-C172688 [TUS-14-C22] Trace: SGN-T195659 EST: SGN-E394333 Direction: 3' Facility: INRA
Clone: SGN-C172688 [TUS-14-C22] Trace: SGN-T195659 EST: SGN-E399033 Direction: 3' Facility: INRA
Clone: SGN-C172688 [TUS-14-C22] Trace: SGN-T199597 EST: SGN-E398271 Direction: 5' Facility: INRA
Clone: SGN-C172688 [TUS-14-C22] Trace: SGN-T199597 EST: SGN-E399034 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202552Length: 526 bp (829 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202552 [] (trimmed) CTTAATGGCTTTATGCAATATTTTTCCTTTTGCCTTCATCATCCTTTCTTGTTCTTGTTATCTGATATCGGGCCAACGTTTCGATTACCCCACTG
CAAACCTTTCTACAACTTGGATCAACAGTGTTTCTGCACCTCATTCAGTGGATTTCACTGATGGCTCAAGAGTTAGGGCTATACTACTCAGAGGA
ACTTTTGGTCCAAAATATGCTTGTGGTTTCTACTGTAATGGCAAATGTGATACTTACCTCTTTGCCATTTTCATCGTGCAAACTAACAGCGCGTC
CCAAATTACTTCTCCATCGATTGGATTCCCACAGGTTGTTTGGTCTGCTAACCGGAATAATCCTGTTAAGATCAATTCAACTTTGCAGTTTACAG
CACAAGGAGACTTGGTGCTTAGAAATGCTGATGGTAGTTTGGCTTGGTCAACTAACACTGCTGGAAAATCTGTTGCTGGTTTAAGCTTGACCGAT
GAAGGGAATCTTGTTCTGTTTGATTCGAAGAATGCAACTGTTTGGCAATCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202552] SGN-U570753 Tomato 200607 Build 2 80 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24213 [Download][View] Facility Assigned ID: TCAAX31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0096 Quality Trim Threshold: 14.5