EST details — SGN-C10849

Search information 
Request: 10849Match: SGN-C10849
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C10849Clone name: cLEC-6-H12
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172719 is on microarray TOM1: SGN-S1-1-4.1.20.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172719 [TUS-14-E5] Trace: SGN-T195109 EST: SGN-E393783 Direction: 3' Facility: INRA
Clone: SGN-C172719 [TUS-14-E5] Trace: SGN-T195564 EST: SGN-E394238 Direction: 3' Facility: INRA
Clone: SGN-C172719 [TUS-14-E5] Trace: SGN-T195564 EST: SGN-E398918 Direction: 3' Facility: INRA
Clone: SGN-C172719 [TUS-14-E5] Trace: SGN-T195565 EST: SGN-E394239 Direction: 5' Facility: INRA
Clone: SGN-C172719 [TUS-14-E5] Trace: SGN-T200171 EST: SGN-E398919 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202556Length: 569 bp (752 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202556 [] (trimmed) CAGGTTGAAAGTAGCCTGAGAGAGCAACTTCATGACCACATCAACGCTGAGATTGTTACTGGAACAATCTCTCATAAAGAGGACGCTATGCATTA
TCTCACTTGGACCTACTTGTTTCGTAGATTGATGGTTAACCCAGCTTACTATGGCCTAGAGCATGCAGAACCTGGGATTCTAAATTCTTATTTGT
CTAGCTTGGTGCAAAGCACATTTGAGGATCTTGAAGACTCTGGATGCATCAAGGTTACCGAGGACAGTGTTGAACCACTGATGTTGGGCTCAATA
GCATCTCAGTATTATCTGAAGTACACCACTGTATCAATGTTTGGCTCAAAAATAGGATCTGATACATCACTTGAGGTTTTCCTACAAATACTGTC
TGGTGCTTCTGAATATGATGAGCTCCCGGTGAGGCATAATGAGGAAAACTACAATGAAAAATTAGCTGAGAAAGTTCCATATGCTGTCGACCACA
ATCGCCTGGATGATCCTCATGTGAAAGCAAATCTGCTCTTTCAGGCTCATTTTTCCCAATCAGAGTTGCCAATCAGCGATTATGTCACAGACTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202556] SGN-U562830 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24217 [Download][View] Facility Assigned ID: TCAAX42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0035 Quality Trim Threshold: 14.5