EST details — SGN-C11038

Search information 
Request: 11038Match: SGN-C11038
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C11038Clone name: cLEC-6-P24
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C182988 is on microarray TOM1: SGN-S1-1-7.1.3.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182988 [TUS-41-A2] Trace: SGN-T1754 EST: SGN-E378217 Direction: 5' Facility: Giov. Lab
Clone: SGN-C182988 [TUS-41-A2] Trace: SGN-T191731 EST: SGN-E390405 Direction: 3' Facility: INRA
Clone: SGN-C182988 [TUS-41-A2] Trace: SGN-T191732 EST: SGN-E390406 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202407Length: 371 bp (814 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202407 [] (trimmed) CAGAAACAAACGAACAATGGGTCCCATTCATTTCTGATGGACGCTAAGTTCGCCGGAAAGCCCATTCAGGCCCAATTTTATTCCGGTCAAACTAA
CCTCGAACAGATGCAGGATACTCCAACCCGCGGGGCACGCCACCGCCGTGCACAATCCGAAACCTTTTTCCGTTTTCCCAGTTTTGATGATGATA
TGCTTTTAGACGATGTCGTTTCTGACTTCAGTCTCGATGTTCAGGCTCCGACCCTCATGCAGCCGGCTAATTCGCCTGATTCTTCGTCTACTGGA
CCAGCGTTGTCGGCTGGACCTTCCGATTACCCTAAGCCGCTGGCTCACTACCGTAGTCTATCTGTTGATGCTGATTTTTTCGATGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202407] SGN-U579936 Tomato 200607 Build 2 25 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T24068 [Download][View] Facility Assigned ID: TCAAX96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0196 Quality Trim Threshold: 14.5