EST details — SGN-C111850

Search information 
Request: 111850Match: SGN-C111850
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C111850Clone name: cTOA-12-M24
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: Alias clone SGN-C182717 is on microarray TOM1: SGN-S1-1-6.1.5.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182717 [TUS-40-E19] Trace: SGN-T191580 EST: SGN-E390254 Direction: 5' Facility: INRA
Clone: SGN-C182717 [TUS-40-E19] Trace: SGN-T191801 EST: SGN-E390475 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E313550Length: 541 bp (881 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E313550 [] (trimmed) GCTAGGAAGGCAACCTGCTGTTCTTCGAACATTTAGCCAGAGATTATGCAGAGGGTTCAATGATGCCATCAATGGATTCGGTGACGATGGCTGGT
CAATGTTAAGTTCAGATGGTGCTGAAGATGTCATAGTTGCTGTCAATTCAAGGAAGAACCTCGCAACCACCTCCATTCCTCTTTCCCCGCTTGGT
GGCGTCCTTTGTGCCAAAGCATCAATGCTACTCCAGAATGTCCCCCCTGCCGTACTGGTTCGGTTTCTGAGGGAGCACCGTTCAGAGTGGGCAGA
CTTTAATGTTGATGCTTTTGTAGCTTCTGCATTGAAGTCTTGTCCGTATACATATCCTGGGATGAGGCCTACCAGATTTACCGGTAGCCAGATAA
TAATGCCACTTGGCCACACAATTGAGCATGAAGATGCTTTTATGCCAAGAGATATTCACCTTTTACAGATGTGTAGTGGCACTGATGAGAATGCA
GTTGGAGCCTGTTCTGAACTAGTTTTTGCCCCTATTGATGAGATGTTTCCAGATGATGCACCTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E313550] SGN-U562744 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T125420 [Download][View] Facility Assigned ID: TFABT84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0072 Quality Trim Threshold: 14.5