EST details — SGN-C111918

Search information 
Request: 111918Match: SGN-C111918
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C111918Clone name: cTOA-13-B9
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: Alias clone SGN-C182250 is on microarray TOM1: SGN-S1-1-1.2.8.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E313448Length: 388 bp (876 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E313448 [] (trimmed) GGTCAAGGGTCACTATCCCAATGAATCTTTCCCTTGCAGTTCTCGCTGAGCTCGATGATCTTACCGTTGGTGGTTTGATCAATGGGTTCGGGGTT
GAAGGAAGTTCTCACATATTTGGGTTGTTCTCTGACACTGTTGTAGCACTTGAGGTTGTTCTAGCTGATGGAAAGGTTGTTAGAGCTACAAAGGA
CAACGAATATTCTGATCTTTTCTACGCTATTCCGTGGTCTCAAGGAACATTGGGGCTTCTTGTTTCAGCTGAAATCAAGCTTATACCAGTTGATC
AATACGTGAAACTTACCTACAAACCTGTAAGGGGTAATCTTAAAGAGCTTGCTCACGCTTACGCGGATTCTTTTGCCCCTAAGATGGAGATCAGG
ACATTCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E313448] SGN-U578468 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T125730 [Download][View] Facility Assigned ID: TFABY05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0161 Quality Trim Threshold: 14.5