EST details — SGN-C112040

Search information 
Request: 112040Match: SGN-C112040
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C112040Clone name: cTOA-13-K20
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: Alias clone SGN-C182755 is on microarray TOM1: SGN-S1-1-8.3.5.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E313435Length: 454 bp (907 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E313435 [] (trimmed) GAAAACACAAATAGGGAGATATTACTATGAAGACAGTAGTTCCTTTTCTTCTCTTCTCTTTGTTTCTTTCTTTGTTTTTAGGAATCTCAGCTGAG
AGGTCTACTTACATTGTCCATTTGGATAAGTCTTTTATGCCTAAAATCTTTGCGACTCACCAAAACTGGCATTCTTACATTATTGATACCATCAA
GATTGAAGCTCCCACTACACAAAATACCCACCATCCACTTCCAAAGCTTCTTTATTCTTATGACAATGTCTTTCATGGCTTCAGTGCTGTGTTGT
CTAAAGATGAACTCGAAGCACTCAAGAAGTCGCCAGGCTTTCTTTCAGCTTATAAAGACAGGCCTGTTGAAGCTCACACTACACATTCCCCTGAG
TTTCTTAAGCTCAATCCTGCTTCAGGGCTATGGCCGGCGTCTGGTTTTGGTGAAGATGTGATCATCGGTGTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E313435] SGN-U581628 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T125717 [Download][View] Facility Assigned ID: TFABX70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5