EST details — SGN-C112231

Search information 
Request: 112231Match: SGN-C112231
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C112231Clone name: cTOA-14-K13
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: Alias clone SGN-C182797 is on microarray TOM1: SGN-S1-1-6.1.6.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182797 [TUS-40-I3] Trace: SGN-T191591 EST: SGN-E390265 Direction: 5' Facility: INRA
Clone: SGN-C182797 [TUS-40-I3] Trace: SGN-T191807 EST: SGN-E390481 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E312948Length: 405 bp (1062 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E312948 [] (trimmed) TCAATCAGGTTATGCCCAGGCTGATCCCAACGCCCAGCGACCTCCCTCTTCTGCATATGGTGCTCCACCAGCTCAGCCAGGTTATGGTGCCCAGT
CTTATGGCGCTCCGCCTAGTTATGGACAGCAGCCACCTCCTTACAACAGCGCCTATGGTGCTTACTCCCAGCCACAAGCATATGCTTCTGAAGCA
GCTCCAACTGCGCAGTCTGTTCCACCTAGTGGTGGGGTTGCCAAAGCTTCACCTCCGAGTTAATATCAGTCTCTTTCGTATGTTTTTGGGTGAAT
CTTTTAAAAACAATTTCTTGCTTTTGTTGCTTAGTTATCTTTAGGTTTTGTAGATTATCAAACAGTGTTTTAAACTGTAGTTTGTTTGTCCCCGT
ATTTGGATTGCGTATCGGTTAAGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E312948] SGN-U583662 Tomato 200607 Build 2 62 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T125791 [Download][View] Facility Assigned ID: TFACA67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0200 Quality Trim Threshold: 12.5