EST details — SGN-C1160

Search information 
Request: 1160Match: SGN-C1160
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C1160Clone name: cLEC-11-B5
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173012 is on microarray TOM1: SGN-S1-1-7.1.20.17
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173012 [TUS-15-A10] Trace: SGN-T188618 EST: SGN-E375764 Direction: 3' Facility: INRA
Clone: SGN-C173012 [TUS-15-A10] Trace: SGN-T188619 EST: SGN-E375765 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201772Length: 448 bp (889 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201772 [] (trimmed) GATTCTTGAAAACTAAACAGTAAAGTTGCAATCTTTAAGCAGCTAAGAAGCAAAAATGGTGAAAATTGGAGAAGGAATTGAAGTCAGAGATGAGC
TAATCAAGAAAACATGTAACTTAACCATGGAAGCTTACAATTTATCACCTGGGAAACCTTATATTTACAAGAAAATTAATGGGTCTACTGATGTT
GTTTTTGCTTTTGCTGGAACTTTGTCTTCTGATGGTTGGTACAAGAACACTTCTTTTGGAGAGAAAGAGATCAACACCACTCTGTTTCCATCTTT
GAGAAGTGTTGGCACTGATGAAGTAGCTAAGGGCAATGAAGTATTTGCTACAAGATTTGAAGAGATACTGGACAAATCTTCACTTAAAAATGAGG
CGGAGAAGGCAATGTTAGAAGGAAGACAGGTAGTGTTTGCAGGGCACTCGGCGGGTGGCGCTATAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201772] SGN-U564893 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25719 [Download][View] Facility Assigned ID: TCABQ03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.930 Expected Error Rate: 0.0195 Quality Trim Threshold: 14.5