EST details — SGN-C123172

Search information 
Request: 123172Match: SGN-C123172
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C123172Clone name: cTOB-9-J12
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
This clone has been mapped as cTOB-9-J12.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E318739Length: 344 bp (746 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E318739 [] (trimmed) TCTCTCTTTTGTTGAACCCGAGTTCATCTTCTTAACAATGGCGCAAATTCCTCATATAGCAATTTTACCTTCTCCTGGTATGGGTCATTTAATCC
CTCTTGTCGAATTTGCTAAGAGAATTTTTCTCCATCATCACTTTTCTGTTTCTCTGATTCTCCCTACTGATGGCCCAATTTCTAACGCTCAGAAA
ATTTTTCTGAACTCGCTTGCTTCTTCCATGGATTATCATCTTCTTCCTCCGGCTAATTTCGATGATTTACCTGAAGATGTTAAAATCGAGACTCG
AATTTCACTTACTGTTTCTCGTTCTCTTACTTCACTGCGTCAAGTTTTGGAATCTATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E318739] SGN-U582049 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T131109 [Download][View] Facility Assigned ID: TFBBJ54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.866 Expected Error Rate: 0.0092 Quality Trim Threshold: 20.5