EST details — SGN-C134417

Search information 
Request: 134417Match: SGN-C134417
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C134417Clone name: cTOD-9-D24
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: Alias clone SGN-C182790 is on microarray TOM1: SGN-S1-1-5.4.5.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182790 [TUS-40-H20] Trace: SGN-T196360 EST: SGN-E395034 Direction: 5' Facility: INRA
Clone: SGN-C182790 [TUS-40-H20] Trace: SGN-T199709 EST: SGN-E398383 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E331434Length: 512 bp (927 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E331434 [] (trimmed) GCACTGCTCCACTGCCTGAAAGGGTCCAGGTTGGTGGATCGCCAGCATATAGGATTGACAGGAAACTTGGTAAAGGAGGATTTGGTCAAGTGTTT
GTAGGTCGTCGTGCGAACCCACCCAATCCACATGAAAGAACTGGCCCAGGAGCAGTAGAGGTTGCCTTGAAATTCGAGCATAGAAGCAGCAAAGG
TTGTAACCATGGACCACCTTATGAGTGGCAGGTCTACAATGCACTTGGTGGCAGTCATGGTATACCGCGTGTTCATTACAAGGGACGTCAAGGTG
ATTACTATATTATGGTTATGGATATGCTTGGTCCTAGTTTATGGGATGTCTGGAACAATAATGCCCATACGATGTCTGTTGAAATGGTCGCATGC
ATTGCCATCGAAGCAATTTCCATACTAGAGAAATTGCACTCCAGAGGGTATGTGCATGGGGATGTAAAACCTGAAAACTTTCTTCTTGGAACCCC
TGGAACTCCTGATGAAAAAAAATTGTTTCTTGTTGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E331434] SGN-U579275 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T143973 [Download][View] Facility Assigned ID: TFDBJ24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0142 Quality Trim Threshold: 14.5