Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C134625

Search information 
Request: 134625Match: SGN-C134625
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C134625Clone name: cTOD-9-P21
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: Alias clone SGN-C182832 is on microarray TOM1: SGN-S1-1-3.2.5.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182832 [TUS-40-J14] Trace: SGN-T196476 EST: SGN-E395150 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E331569Length: 589 bp (933 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E331569 [] (trimmed) GAGAACACCAGCAAAAATGAGTCGCTCAACTATTCCTTTGCTATGGGCATTCTTAATCTTGTTCGCGTCCTCTGCCTCAGCCTTTAATATCACAA
AAATCCTCGGTCAATATTCCGATTACAGTACATTCAATGAACTTCTATCGAAATCTGGCTTAGCTAGCGATATTAATTCGAGGGGTACAATTACA
CTTTTAGCTGTACCAAATGGTGCAGTTGGTGATCTTACATCGAAATCAGATGATGTTCTTAAGAGAGTGTTGGCTACACATGTCGTATTGGATTA
CTACGATCCAATGAAACTTCAGAAGATGAAGGACAAAACAGCGAAGATGACGACAATGTTTCAACAATCTGGTAAAGCAGCGTATGATCAAGGTT
TCCTAAATGTTACTGCTAAAGATGGTAGTTTCGTGTTTGGTTCAGCTGTAGTTGGTGCTCAAAGAGATTCAAAACTTGAGAAATCCGTTATGAAT
CAGCCTTACAATATCTCGATTCTTGGAATTTCTCAACCTATTGTTACGCCTGGTCTCGATGGAACAATGGCACCGATTTCAGCTCCACCACCAAA
GGCACACACGCCTAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E331569] SGN-U583299 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T144108 [Download][View] Facility Assigned ID: TFDBI95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5