Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C137572

Search information 
Request: 137572Match: SGN-C137572
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C137572Clone name: cTOE-22-P20
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: Alias clone SGN-C184598 is on microarray TOM1: SGN-S1-1-5.4.14.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184598 [TUS-45-D4] Trace: SGN-T198778 EST: SGN-E397452 Direction: 5' Facility: INRA
Clone: SGN-C184598 [TUS-45-D4] Trace: SGN-T200057 EST: SGN-E398731 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E341189Length: 140 bp (1162 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E341189 [] (trimmed) TGTAGATCAGCCTATTATCGACTATATTATCAATGTCGTCGCCGATGAAGATTTCTATTTTGGTCACGACAGTGAAGGTGCTGTTGAAGCCCTTG
GAGAGCTACTTGTCCATTCCGGTTGTGTTACTGACTGCTTCGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E341189] SGN-U566380 Tomato 200607 Build 2 58 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T152378 [Download][View] Facility Assigned ID: TAIDJ94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0442 Quality Trim Threshold: 14.5