SGN ID: SGN-C137572 | Clone name: cTOE-22-P20 |  | Order Clone |
|
Library Name: cTOE | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)
Microarray: Alias clone
SGN-C184598 is on microarray TOM1: SGN-S1-1-5.4.14.7
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E341189 | Length: 140 bp (1162 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E341189 [] (trimmed)
TGTAGATCAGCCTATTATCGACTATATTATCAATGTCGTCGCCGATGAAGATTTCTATTTTGGTCACGACAGTGAAGGTGCTGTTGAAGCCCTTG
GAGAGCTACTTGTCCATTCCGGTTGTGTTACTGACTGCTTCGAAT
[BLAST] [AA Translate]
SGN-ID: SGN-T152378 [Download][View] |
Facility Assigned ID: TAIDJ94TH
|
Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 |
Expected Error Rate: 0.0442 |
Quality Trim Threshold: 14.5 |