EST details — SGN-E138185

Search information 
Request: 138185Match: SGN-E138185
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C82221Clone name: cLET-1-E23
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C185273 is on microarray TOM1: SGN-S1-1-2.4.12.16
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82221 [cLET-1-E23] Trace: SGN-T102359 EST: SGN-E292085 Direction: 3' Facility: TIGR
Clone: SGN-C82221 [cLET-1-E23] Trace: SGN-T102563 EST: SGN-E292289 Direction: 5' Facility: TIGR
Clone: SGN-C185273 [TUS-46-P7] Trace: SGN-T199065 EST: SGN-E397739 Direction: 5' Facility: INRA
Clone: SGN-C185273 [TUS-46-P7] Trace: SGN-T200113 EST: SGN-E398787 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E138185Length: 263 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 3' [See links to 5' reads above]
>SGN-E138185 [] (called/trimmed by facility)
ACAGCCCAAAAAAGCTGGTTTTAATCACAAAATGACATTACATGGATACATATGCAACTTTAATTTCCTGAGTTTTCATTACCCCTCAAAAAGAG
AAGGGCAATTCTAAAAGGAAAATGTTGAAATTGATGGGAACTCAAATCAACTTTTACAAAACAGAGGGGTGAAAAAAATTAGTTGACAGTAACTT
TGCCAACCATTCCAGCTCCCTGGGGAGGGGCACAGTAAAAAGTGTAAGTTCCTTTCTCACTCAAAGGGACACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T102359 [Download][View] Facility Assigned ID: TMEAA36TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence