EST details — SGN-C14147

Search information 
Request: 14147Match: SGN-C14147
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14147Clone name: cLEC-7-A17
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C172857 is on microarray TOM1: SGN-S1-1-2.2.20.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172857 [TUS-14-J23] Trace: SGN-T195903 EST: SGN-E394577 Direction: 3' Facility: INRA
Clone: SGN-C172857 [TUS-14-J23] Trace: SGN-T195904 EST: SGN-E394578 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E201918Length: 458 bp (738 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E201918 [] (trimmed) CTTTAGAAGAGGAAGAAGCAGCAATTGGTGTTGGCACAGTGGGGTCATCAGAGGCCATAATGTTAGCGGGCCTAGCCTTCAAGAGGAACTGGCAA
AACAAACGCAAAGCTGAGGGAAAGCCTTATGATAAGCCCAATATTGTTACTGGCGCTAATGTTCAGGTGTGTTGGGAGAAATTTGCAAACTACTT
TGAAGTGGAATTGAAAGAAGTAAAGCTAAGGGAAGGGTACTATGTGATGGATCCAATGAAAGCTGTGGAAATGGTAGATGACAACACCATTTGTG
TTGCTGCTATTTTGGGTTCAACTCTTAATGGAGAATTTGAAGATGTCAAACTCTTGAATGATCTACTCATTCAAAAGAACAAGCAAACTGGATGG
GATACACCAATTCATGTGGATGCAGCTAGTGGTGGATTCATTGCACCATTTATCTACCCAGAGTTGGAATGGGACTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E201918] SGN-U578934 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25200 [Download][View] Facility Assigned ID: TCAAY09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0052 Quality Trim Threshold: 14.5