EST details — SGN-C14269

Search information 
Request: 14269Match: SGN-C14269
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C14269Clone name: cLEC-7-G12
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C180818 is on microarray TOM1: SGN-S1-1-1.2.17.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180818 [TUS-35-F16] Trace: SGN-T193689 EST: SGN-E392363 Direction: 5' Facility: INRA
Clone: SGN-C180818 [TUS-35-F16] Trace: SGN-T199201 EST: SGN-E397875 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E202141Length: 421 bp (738 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E202141 [] (trimmed) CCTCTTACCCATACTCCAAATTAATATTAACCCTATCTTTTCTCATATATCCACAAACTCCTTTATTACCTTTGCCAAGATCCTCTATCTTCTTA
ACTTTGACATTGACTCAAAAATATTGTTATACTCATCTTTGTTGAAGAATCAAAGCATGGATCATTTTGGTAATTTAATAAAAGAAGAGTTTGAT
GGATCATTTTTGACGCCTCAACCGAAGGAGTGTCTTCATGAGAATGGACCTCCACCATTTCTTACAAAAACATATGAACTTGTGGATGATCCAAG
TAACAACGACGTCGTTTCTTGGAGTAGAGGTTACAATAGTTTCATAGTATGGGATCCCCAGAATTTGGCCATTAATTTTCTACCAAGGTATTTCA
AGCATAACAATTTCTCAAGCTTTGTCAGGCAGCTCAATACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E202141] SGN-U580800 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T25423 [Download][View] Facility Assigned ID: TCAAZ42TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0099 Quality Trim Threshold: 14.5